Review



ap2a1 sirnas  (Shanghai Generay Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Shanghai Generay Biotech ap2a1 sirnas
    Ap2a1 Sirnas, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a1+sirnas/ap2a1+sirnas/pm42073635-83-5-10
    Average 86 stars, based on 1 article reviews
    ap2a1 sirnas - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: MDK Activates the PI3K/AKT Axis to Induce AP2A1 Expression and Epithelial–Mesenchymal Transition in Colorectal Cancer
    Article Snippet: .. Commercially synthesized human MDK and AP2A1 siRNAs were purchased from Shanghai Generay Biotech Co., Ltd. (Shanghai, China), with detailed information listed in . .. Transfection was performed using GyRransTM -RNA&DNA (GT1003, Shanghai Generay Biotech Co., Ltd., Shanghai, China) following the manufacturer’s instructions.

    Article Title: MDK Activates the PI3K/AKT Axis to Induce AP2A1 Expression and Epithelial-Mesenchymal Transition in Colorectal Cancer.
    Article Snippet: .. Commercially synthesized human MDK and AP2A1 siRNAs were purchased from Shanghai Generay Biotech Co., Ltd. (Shanghai, China), with detailed information listed in Supplementary Table S3. .. Commercially synthesized human MDK and AP2A1 siRNAs were purchased from Shanghai Generay Biotech Co., Ltd. (Shanghai, China), with detailed information listed in Supplementary Table S3.



    Similar Products

    sirnas targeting ap2a1 s183 and s184  (Thermo Fisher)
    90
    Thermo Fisher sirnas targeting ap2a1 s183 and s184
    Sirnas Targeting Ap2a1 S183 And S184, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a1+sirnas/sirnas+against+alpha+adaptin/pm39848456-116-1-7
    Average 90 stars, based on 1 article reviews
    sirnas targeting ap2a1 s183 and s184 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    ap2a1 sirnas  (Shanghai Generay Biotech)
    86
    Shanghai Generay Biotech ap2a1 sirnas
    Ap2a1 Sirnas, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a1+sirnas/ap2a1+sirnas/pm42073635-83-5-10
    Average 86 stars, based on 1 article reviews
    ap2a1 sirnas - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    ap2a1 sirna  (Qiagen)
    90
    Qiagen ap2a1 sirna
    Ap2a1 Sirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a1+sirnas/ap2a1+sirna/pmc07533725-83-75-77
    Average 90 stars, based on 1 article reviews
    ap2a1 sirna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    human ap2a1 sirna  (Eurofins)
    90
    Eurofins human ap2a1 sirna
    A . Western blotting confirmed efficiency of the MEX3C and AP-2 siRNAs. MEX3C was detected 24 hours after <t>siRNA</t> transfection; the loading control was β-actin. AP-2 α and AP-2 μ2 were examined 84 hours after siRNA transfection (after EV collection). The loading control was GAPDH. The panel on the right shows the relative expression after normalized to loading control determined by densitometry. Results are representative of two independent experiments. B . Real-time PCR analysis of EV RNA expression after MEX3C or AP-2 inhibition. Because inhibiting AP-2 α or AP-2 μ, or AP-2 α and AP-2 μ in HEK293T cells showed similar effects, these data were combined. * indicates p<0.001 by Tukey's multiple comparison test following ANOVA. For miR-451a and miR-320a, N = 3; for the others, N = 2. C . MEX3C or AP-2 inhibition did not affect cellular miR-451a expression (N = 3). D . EV miR-451a was protected from RNase by membrane (N = 5). ***, p<0.0001 between protease K and RNase treated samples with and without NP40 pre-treatment, analyzed by Tukey's multiple comparison test following ANOVA. For B , C and D , means ± standard error (s.e.m.) are shown.
    Human Ap2a1 Sirna, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ap2a1+sirnas/human+ap2a1+sirna/pmc05628917-67-0-19
    Average 90 stars, based on 1 article reviews
    human ap2a1 sirna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A . Western blotting confirmed efficiency of the MEX3C and AP-2 siRNAs. MEX3C was detected 24 hours after siRNA transfection; the loading control was β-actin. AP-2 α and AP-2 μ2 were examined 84 hours after siRNA transfection (after EV collection). The loading control was GAPDH. The panel on the right shows the relative expression after normalized to loading control determined by densitometry. Results are representative of two independent experiments. B . Real-time PCR analysis of EV RNA expression after MEX3C or AP-2 inhibition. Because inhibiting AP-2 α or AP-2 μ, or AP-2 α and AP-2 μ in HEK293T cells showed similar effects, these data were combined. * indicates p<0.001 by Tukey's multiple comparison test following ANOVA. For miR-451a and miR-320a, N = 3; for the others, N = 2. C . MEX3C or AP-2 inhibition did not affect cellular miR-451a expression (N = 3). D . EV miR-451a was protected from RNase by membrane (N = 5). ***, p<0.0001 between protease K and RNase treated samples with and without NP40 pre-treatment, analyzed by Tukey's multiple comparison test following ANOVA. For B , C and D , means ± standard error (s.e.m.) are shown.

    Journal: PLoS ONE

    Article Title: MEX3C interacts with adaptor-related protein complex 2 and involves in miR-451a exosomal sorting

    doi: 10.1371/journal.pone.0185992

    Figure Lengend Snippet: A . Western blotting confirmed efficiency of the MEX3C and AP-2 siRNAs. MEX3C was detected 24 hours after siRNA transfection; the loading control was β-actin. AP-2 α and AP-2 μ2 were examined 84 hours after siRNA transfection (after EV collection). The loading control was GAPDH. The panel on the right shows the relative expression after normalized to loading control determined by densitometry. Results are representative of two independent experiments. B . Real-time PCR analysis of EV RNA expression after MEX3C or AP-2 inhibition. Because inhibiting AP-2 α or AP-2 μ, or AP-2 α and AP-2 μ in HEK293T cells showed similar effects, these data were combined. * indicates p<0.001 by Tukey's multiple comparison test following ANOVA. For miR-451a and miR-320a, N = 3; for the others, N = 2. C . MEX3C or AP-2 inhibition did not affect cellular miR-451a expression (N = 3). D . EV miR-451a was protected from RNase by membrane (N = 5). ***, p<0.0001 between protease K and RNase treated samples with and without NP40 pre-treatment, analyzed by Tukey's multiple comparison test following ANOVA. For B , C and D , means ± standard error (s.e.m.) are shown.

    Article Snippet: Control siRNA against firefly luciferase (CUUACGCUGAGUACUUCGA), human AP2A1 siRNA (AAGAGCAUGUGCACGCUGGCCA), human AP2M1 siRNA (AAGUGGAUGCCUUUCGGGUCA) [ ] were synthesized by Eurofins MWG Operon LLC (Louisville, KY;, all contained a 3’ overhang of dTdT.

    Techniques: Western Blot, Transfection, Control, Expressing, Real-time Polymerase Chain Reaction, RNA Expression, Inhibition, Comparison, Membrane

    A . siRNA-mediated MEX3C or AP-2 inhibition reduced miR-451a in exosome-enriched preparations. For AP-2 inhibition, siRNAs for AP2A1 and AP2M1 were transfected simultaneously. Shown are representative data from two independent transfections. B . DOX-induction inhibited MEX3C expression at the RNA level (N = 3). C . shRNA targeting the MEX3C coding region inhibited MEX3C expression from pFlag-MEX3C-1 after DOX-induction (N = 2). Co-transfected EGFP expression was used as the control for transfection efficiency and loading. D . DOX-induced MEX3C inhibition decreased exosomal miR-451a but not miR-320a expression (N = 3). For B and D , the mean ± s.e.m. are presented. *, ** and *** indicate p<0.05, 0.01 and 0.0001 when compared with control in Tukey’s multiple tests ( B ) and Bonferroni posttests ( D ).

    Journal: PLoS ONE

    Article Title: MEX3C interacts with adaptor-related protein complex 2 and involves in miR-451a exosomal sorting

    doi: 10.1371/journal.pone.0185992

    Figure Lengend Snippet: A . siRNA-mediated MEX3C or AP-2 inhibition reduced miR-451a in exosome-enriched preparations. For AP-2 inhibition, siRNAs for AP2A1 and AP2M1 were transfected simultaneously. Shown are representative data from two independent transfections. B . DOX-induction inhibited MEX3C expression at the RNA level (N = 3). C . shRNA targeting the MEX3C coding region inhibited MEX3C expression from pFlag-MEX3C-1 after DOX-induction (N = 2). Co-transfected EGFP expression was used as the control for transfection efficiency and loading. D . DOX-induced MEX3C inhibition decreased exosomal miR-451a but not miR-320a expression (N = 3). For B and D , the mean ± s.e.m. are presented. *, ** and *** indicate p<0.05, 0.01 and 0.0001 when compared with control in Tukey’s multiple tests ( B ) and Bonferroni posttests ( D ).

    Article Snippet: Control siRNA against firefly luciferase (CUUACGCUGAGUACUUCGA), human AP2A1 siRNA (AAGAGCAUGUGCACGCUGGCCA), human AP2M1 siRNA (AAGUGGAUGCCUUUCGGGUCA) [ ] were synthesized by Eurofins MWG Operon LLC (Louisville, KY;, all contained a 3’ overhang of dTdT.

    Techniques: Inhibition, Transfection, Expressing, shRNA, Control

    A . HGS was efficiently inhibited by siRNA si-HGS-2 but not si-HGS-1 . Right: Expression as measured by densitometry (normalized with β-actin expression). Shown are representative results from two experiments. B . Inhibiting HGS expression failed to decrease exosomal miR-451a expression (N = 2). C . GW4869 significantly inhibited exosomal miR-451a expression (N = 3). The mean ± s.e.m. are shown. * indicates p<0.05 compared with DMSO control in Bonferroni posttests following ANOVA. D . Proposed model for AP-2/MEX3C interaction. At least two regions in MEX3C are necessary for its interaction with AP-2 complex. The red question mark indicates uncertainty whether the MEX3C/AP-2 interaction is direct or indirect; the black question mark indicates that the identities of the substrates ubiquitinated by MEX3C ring finger domain, and the proteins that directly bind microRNA, are unknown. E . Proposed role of MEX3C in ceramide-mediated miRNA exosomal sorting. MEX3C increases the association of microRNA to the endosome. ILV: intraluminal vesicles; MVB: multivesicular body; *: ceramide. It is unknown whether MEX3C itself is sorted into the ILVs, so MEX3C was not shown in ILVs.

    Journal: PLoS ONE

    Article Title: MEX3C interacts with adaptor-related protein complex 2 and involves in miR-451a exosomal sorting

    doi: 10.1371/journal.pone.0185992

    Figure Lengend Snippet: A . HGS was efficiently inhibited by siRNA si-HGS-2 but not si-HGS-1 . Right: Expression as measured by densitometry (normalized with β-actin expression). Shown are representative results from two experiments. B . Inhibiting HGS expression failed to decrease exosomal miR-451a expression (N = 2). C . GW4869 significantly inhibited exosomal miR-451a expression (N = 3). The mean ± s.e.m. are shown. * indicates p<0.05 compared with DMSO control in Bonferroni posttests following ANOVA. D . Proposed model for AP-2/MEX3C interaction. At least two regions in MEX3C are necessary for its interaction with AP-2 complex. The red question mark indicates uncertainty whether the MEX3C/AP-2 interaction is direct or indirect; the black question mark indicates that the identities of the substrates ubiquitinated by MEX3C ring finger domain, and the proteins that directly bind microRNA, are unknown. E . Proposed role of MEX3C in ceramide-mediated miRNA exosomal sorting. MEX3C increases the association of microRNA to the endosome. ILV: intraluminal vesicles; MVB: multivesicular body; *: ceramide. It is unknown whether MEX3C itself is sorted into the ILVs, so MEX3C was not shown in ILVs.

    Article Snippet: Control siRNA against firefly luciferase (CUUACGCUGAGUACUUCGA), human AP2A1 siRNA (AAGAGCAUGUGCACGCUGGCCA), human AP2M1 siRNA (AAGUGGAUGCCUUUCGGGUCA) [ ] were synthesized by Eurofins MWG Operon LLC (Louisville, KY;, all contained a 3’ overhang of dTdT.

    Techniques: Expressing, Control